EnhancerDB
  1. Home
  2. TFBS
  3. NKX2-3[chr1:111037137-111037147]
Chromosome characteristics of NKX2-3[chr1:111037137-111037147]
Back to top
Enhancers possibly regulated by NKX2-3[chr1:111037137-111037147]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 111033365 111040875 enh74366
Muscle (A673) Ovary
SNP sites on NKX2-3[chr1:111037137-111037147]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 111037145 rs373873103 GCTCCTTCTCCTTCAAGGCCAGC G 553278
chr1 111037145 rs377256484 GCTCCTTCTCCTTCAAGGCCAGC G 553279
chr1 111037145 rs564392682 G T 553280
chr1 111037146 rs147802795 C T 553281
Genes possibly regulated by NKX2-3[chr1:111037137-111037147]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NKX2-3[chr1:111037137-111037147]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results