EnhancerDB
  1. Home
  2. TFBS
  3. SP1[chr1:111047554-111047559]
Chromosome characteristics of SP1[chr1:111047554-111047559]
Back to top
Enhancers possibly regulated by SP1[chr1:111047554-111047559]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 111043145 111060775 enh557
Muscle (Myotube) Placenta Blood (Karpas-422)
SNP sites on SP1[chr1:111047554-111047559]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 111047557 rs541224827 GCGGAGGCAGAAGAATCGCT G 553396
chr1 111047558 rs548446474 C A,T 553397
Genes possibly regulated by SP1[chr1:111047554-111047559]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SP1[chr1:111047554-111047559]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results