Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 111428645 111432795 enh107400

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 111429668 rs191867658 G A 555615
chr1 111429680 rs150758437 G GTTTAT,GTTTATTTTATTTTATTTTAT 555616
chr1 111429680 rs71096370 G GTTTAT 555617

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results