Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 111690585 111698515 enh561

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 111696809 rs201981261 GTATTTTATTTTATTTTATTTTATTT G 556851
chr1 111696809 rs568105665 GTATTTTATTTTATTTTATTTTATTT G 556852

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results