Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 112971645 112975795 enh94042

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 112973355 rs541651174 TTTAGTAGAGACTAAAATACATG T 564367

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results