| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr3 | 8861925 | 8869355 | enh54003 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr3 | 8865906 | rs139927190 | CTGCTTCATCACCTATTAGTGATGCTTCACTAATAGG | C | 6536758 | |
| chr3 | 8865906 | rs368037820 | CTGCTTCATCACCTATTAGTGATGCTTCACTAATAGG | C | 6536759 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|