Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 113709745 113714495 enh87628

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 113713349 rs144210805 CCGTGGACTCCTGCAGTCCCAGCCATG C 568704
chr1 113713349 rs370416374 CCGTGGACTCCTGCAGTCCCAGCCATG C 568705
chr1 113713349 rs71590546 CCGTGGACTCCTGCAGTCCCAGCCATG C 568706

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results