Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 115443045 115447195 enh95385

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 115446768 rs591544 T C 577138
chr1 115446769 rs474584 G A 577139
chr1 115446777 rs142337128 G A 577140
chr1 115446779 rs530937872 CCAGGCTGGAGTGCAGTGGTGCG C 577141

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results