EnhancerDB
  1. Home
  2. TFBS
  3. DMRT3[chr1:116293508-116293519]
Chromosome characteristics of DMRT3[chr1:116293508-116293519]
Back to top
Enhancers possibly regulated by DMRT3[chr1:116293508-116293519]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 116289145 116302775 enh12180
Prostate (PC-3) Esophagus Astrocyte Lung Placenta Thyroid Lung (PC-9) Heart
SNP sites on DMRT3[chr1:116293508-116293519]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 116293517 rs374488738 C CTGTAGGTATGTATCGCACCTACAGGA 582788
chr1 116293517 rs6143392 C CTGTAGGTATGTATCGCACCTACAGGA 582789
Genes possibly regulated by DMRT3[chr1:116293508-116293519]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by DMRT3[chr1:116293508-116293519]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results