Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 117432085 117436235 enh12191

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 117433519 rs369309747 TCCTTCTGCTCTCCCCAGCCCCTGGTAG T 592471
chr1 117433519 rs373106811 TCCTTCTGCTCTCCCCAGCCCCTGGTAG T 592472
chr1 117433538 rs12026346 C G,T 592473

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results