Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 117512225 117516375 enh27106

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 117513903 rs147216504 C T 593037
chr1 117513904 rs561844700 T TTAGCCATTACCCTATTGATGGTGC 593038

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results