Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 117929025 117934175 enh587

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 117929347 rs140489605 T TCCCTGTCTCTAGAGTCCCTGTTTCTAGAGA 595540
chr1 117929347 rs71100318 T TCCCTGTCTCTAGAGTCCCTGTTTCTAGAGA 595541

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results