Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 153332949 153346154 enh12267

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 153333344 rs548370037 CGGCCACGGCCACAGTCATGGT C 633202

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results