Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 157626500 157631895 enh60176

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 157626688 rs567549401 ATAAGTACTTAACAAATTATAACAATT A 656177
chr1 157626690 rs142726734 A G 656178

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results