Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 165492985 165502715 enh64117

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 165499159 rs545434029 T TATACACACATTGTATTTAATAATTATAC 693935
chr1 165499159 rs71097579 T TATACACACATTGTATTTAATAATTATAC 693936

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results