Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 166839305 166843455 enh92119

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 166842319 rs140549869 CCAACATGGCGAAACCCCGTCT C 698434
chr1 166842329 rs190223291 G A 698435

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 166825747 166845564 - TADA1 ENSG00000152382.5 166845564 0.63 0.99 3233 1524


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results