Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 171427385 171431535 enh50043

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 171431004 rs117620272 A T 724471
chr1 171431019 rs538976448 G A 724472
chr1 171431019 rs539790030 G GAAGGAAGGAAGGAAGGGACA 724473

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results