Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 171970002 171977235 enh79252

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 171972860 rs113762623 TGAATAATTTATTGCCTATTGACATA T 726560
chr1 171972860 rs369057099 TGAATAATTTATTGCCTATTGACATA T 726561

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results