Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 172637585 172654275 enh50047

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 172641155 rs529038445 CATAATTCATTCATTCATTTACTCATAGT C 730138

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results