Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 172834705 172846575 enh85986

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 172842790 rs554865403 TCCTCAAGCTGGAACCCTCTGTGG T 731519

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results