Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 178586365 178592195 enh757

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 178592110 rs572978737 CAATTGGTGCTTTTTACCCTCATGGAGA C 755219

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results