Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 179114165 179118335 enh27287

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 179116234 rs369914005 AACAG A 758895
chr1 179116245 rs545458469 T TCCAAAGATGACACATAGGTGG 758896

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results