Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 182884526 182888874 enh60199

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 182887910 rs557775382 AATAGTGTGGTACTGGCATAAAGATAGGCAT A 776923

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results