Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 201249258 201261175 enh12517

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 201253216 rs367607060 C CGCGACCCGAGGCTGGCTCGACG 852260
chr1 201253216 rs541557736 C CGCGACCCGAGGCTGGCTCGACG 852261

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 201252580 201302121 + PKP1 ENSG00000081277.7 201252580 0.95 0.99 627 1703


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results