Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 203119645 203127655 enh12550

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 203121701 rs149200581 TGGGATGGTTTTTTCCTGTCCCAC T 865437
chr1 203121701 rs72372371 TGGGATGGTTTTTTCCTGTCCCAC T 865438

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results