Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 205075505 205083915 enh892

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 205078380 rs375918001 A AGGGTAAAAGGGTGGATGATGGGAGG 880772

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results