Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 207821445 207825595 enh90761

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 207821718 rs75352843 A G 895393
chr1 207821724 rs370072283 TTAAATCAAGACAGGTATGAAACC T 895394
chr1 207821724 rs370138110 TTAAATCAAGACAGGTATGAAACC T 895395

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results