Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 208608865 208613015 enh79335

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 208609888 rs565768360 GTAGTCAGGGAGAACCTTATGGACTTATTT G 900752

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results