Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 210799205 210809319 enh43131

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 210805000 rs563795404 GCTGTCATAAGAGCTGAGGGCCTGTGA G 913189

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results