Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 227420623 227426710 enh85996

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 227422417 rs539200690 CAGACAGACATTCCCAAGTTCAAAATTTGTA C 996687
chr1 227422423 rs553130656 G A 996688

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results