EnhancerDB
  1. Home
  2. TFBS
  3. HiNF-A[chr1:227601796-227601802]
Chromosome characteristics of HiNF-A[chr1:227601796-227601802]
Back to top
Enhancers possibly regulated by HiNF-A[chr1:227601796-227601802]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 227601205 227607735 enh27593
Astrocyte Large Intestine
SNP sites on HiNF-A[chr1:227601796-227601802]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 227601801 rs55945803 ATGGGGGAACAGCCAGTCAG A 998112
chr1 227601801 rs67198731 ATGGGGGAACAGCCAGTCAG A 998113
chr1 227601801 rs748737521 ATGGGGGAACAGCCAGTCAG A 998114
Genes possibly regulated by HiNF-A[chr1:227601796-227601802]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by HiNF-A[chr1:227601796-227601802]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results