Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 230474629 230480195 enh64204

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 230479931 rs370164895 T TGAGGCAGGAGAATGGTGTG 1017043
chr1 230479931 rs539415431 T TGAGGCAGGAGAATGGTGTG 1017044

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results