| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 231221545 | 231226295 | enh111606 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 231225171 | rs184807052 | C | T | 1021667 | |
| chr1 | 231225172 | rs375490300 | ATTTGAAACCTTAGATGAAATGGATACATGCCAAAAAAAATACATC | A | 1021668 | |
| chr1 | 231225172 | rs575351739 | ATTTGAAACCTTAGATGAAATGGATACATGCCAAAAAAAATACATC | A | 1021669 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|