Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 231666825 231671015 enh92164

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 231668887 rs368645955 A G 1023528
chr1 231668893 rs539012804 ACCTCCGCCTCCCAGGTTCAAGCAATTCTCCTG A 1023529

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results