EnhancerDB
  1. Home
  2. TFBS
  3. ATF4[chr1:233597729-233597742]
Chromosome characteristics of ATF4[chr1:233597729-233597742]
Back to top
Enhancers possibly regulated by ATF4[chr1:233597729-233597742]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 233593036 233597820 enh86839
Blood (GM12878)
SNP sites on ATF4[chr1:233597729-233597742]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 233597730 rs66783455 G A 1035966
chr1 233597734 rs376633682 GATGCCATCAGAGCCAGAGGA G 1035967
Genes possibly regulated by ATF4[chr1:233597729-233597742]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ATF4[chr1:233597729-233597742]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results