Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 237047573 237058515 enh64216

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 237053432 rs144334870 TTGCCAAGTTTCCCACGGGGGGGCG T 1059014
chr1 237053436 rs188364684 C T 1059015

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results