Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 240654505 240669115 enh12822

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 240664943 rs574116413 AGTGGGCTGCTTCTCTCTAGGGTACATCCAT A 1072473

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results