Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 245356745 245367275 enh12857

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 245367006 rs371195623 CTCCCTGGAGGTGCCGCATGAAAGCGCTTT C 1093628
chr1 245367006 rs576066723 CTCCCTGGAGGTGCCGCATGAAAGCGCTTT C 1093629
chr1 245367015 rs559386309 G C 1093630

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results