Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 245827865 245841195 enh1017

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 245836394 rs551356946 T C 1096719
chr1 245836396 rs534213123 C CCATCTTAGGCCCAGTCCCCACTGCGCGCTGT 1096720
chr1 245836396 rs76244117 C T 1096721

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results