Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 1322743 1329761 enh89597

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 1327172 rs563331851 GGGGGCCCGCACGGTACCCCTCGCA G 1792522

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 1295601 1330884 - TOLLIP ENSG00000078902.11 1330884 0.77 1.0 3705 10388


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results