| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 1322743 | 1329761 | enh89597 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 1327172 | rs563331851 | GGGGGCCCGCACGGTACCCCTCGCA | G | 1792522 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr11 | 1295601 | 1330884 | - | TOLLIP | ENSG00000078902.11 | 1330884 | 0.77 | 1.0 | 3707 | 10388 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|