EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr11:2129812-2129833]
Chromosome characteristics of ZNF263[chr11:2129812-2129833]
Back to top
Enhancers possibly regulated by ZNF263[chr11:2129812-2129833]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 2126698 2133125 enh13691
Muscle (Myotube) Placenta Heart
SNP sites on ZNF263[chr11:2129812-2129833]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 2129819 rs367969309 C CCAGCCCCCTCCTCCTTCCCCA 1799479
chr11 2129819 rs543356367 C CCAGCCCCCTCCTCCTTCCCCA 1799480
Genes possibly regulated by ZNF263[chr11:2129812-2129833]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr11:2129812-2129833]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results