Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 2779405 2787515 enh101236

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 2782492 rs111605339 GGCCTGTCGGTGCCTGTTGGT G 1805842
chr11 2782492 rs56813468 GGCCTGTCGGTGCCTGTTGGT G 1805843
chr11 2782500 rs537737120 G A 1805844

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results