Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 3129273 3135695 enh89601

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 3135377 rs574797518 AAAGAAAGCATGTCCTTTTG A 1808826

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results