Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 8668925 8673283 enh28575

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 8671263 rs11268493 G GGCAGGGAGAGGTGGGATTGGT 1829379
chr11 8671263 rs543413586 G GGCAGGGAGAGGTGGGATTGGT 1829380

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results