Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 8763936 8771055 enh50703

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 8767650 rs145101250 GGCCACAGGGCCTCCTAAGGGGGGCCT G 1830012
chr11 8767650 rs72273441 GGCCACAGGGCCTCCTAAGGGGGGCCT G 1830013

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results