Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 8859965 8865735 enh28576

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 8862376 rs530356947 CCTGGCCACGGAACTGAAAGCCTAAGAA C 1830972
chr11 8862385 rs371115012 G A 1830973

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results