Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 10623985 10628235 enh28586

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 10624166 rs11042893 A G 1842160
chr11 10624173 rs148223512 AGACAGGATATTTATAGGGTT A 1842161

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results