Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 14380685 14384835 enh13798

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 14383967 rs564123003 T TGCCAAAATGAGCTCTTTCCCTAAGAAA 1869026

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 14299472 14386052 - RRAS2 ENSG00000133818.8 14386052 0.64 0.99 2078 10593


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results