Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 15228245 15232395 enh111733

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 15231917 rs376413353 AGCCTGTTCTGTGGGCTACAGACAT A 1871994
chr11 15231917 rs546887014 AGCCTGTTCTGTGGGCTACAGACAT A 1871995

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results